주석
K-MOOC은 이 도구에 대해 부분적인 지원을 제공한다.
UMB 생물학과에서 만든 유전자 탐색기 (GeneX)는 전사, 접합, 처리 및 가상의 작은 유전자 핵의 변형을 시뮬레이션한다. GeneX는 학습자가 유전자 시퀀스에 특정 돌연변이를 만들 수 있도록 하며, mRNA와 단백질에 있는 돌연변이 수를 계산하고 이들 돌연변이의 효과를 표시한다.
특히, 유전자 탐색기는 다음을 수행한다.
유전자 탐색기에대한 추가 정보를 위해 The Gene Explorer 를 살펴본다.
<problem>
<p>Make a single base pair substitution mutation in the gene below that results in a protein that is longer than the protein produced by the original gene. When you are satisfied with your change and its effect, click the <b>SUBMIT</b> button.</p>
<p>Note that a "single base pair substitution mutation" is when a single base is changed to another base; for example, changing the A at position 80 to a T. Deletions and insertions are not allowed.</p>
<script type="loncapa/python">
def genex_grader(expect,ans):
if ans=="CORRECT": return True
import json
ans=json.loads(ans)
return ans["genex_answer"]=="CORRECT"
</script>
<customresponse cfn="genex_grader">
<editageneinput width="818" height="1000" dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_problem_number="2"/>
</customresponse>
</problem>
이 코드에서: